20200331 Day 91: How Chloroquine affects Viruses in the Multiverse

 

1-s2.0-S0924857920300881-gr1
A composite of some of the ways Chloroquine acts as an antiviral in the multiverse. From Devaux, et. al. Mar. 2020 https://doi.org/10.1016/j.ijantimicag.2020.105938

Since I’m posting a day late and trying to catch back up, I wanted to make a short post about this recent journal article which summarizes past research on the antiviral properties of Chloroquine. Since the COVID-19 pandemic is such a big effect on the world right now, I was curious if ripples of this event could be felt in the past. I found the following:

1. Effects of Chloroquine on viral infections, an old drug against today’s diseases, Savarino et. al., Nov. 2003

We raise the question of whether this old drug whose parent compound, quinine, was isolated in the late 19th century from the bark of the tropical cinchona tree, may experience a revival in the clinical management of viral diseases of the era of globalisation.

and also this quote seems relevant due to possibility that SARS-CoV-2 induced cytokine storm is being seen in some COVID-19 patients:

The chloroquine/hydroxychloroquine-induced suppression of the synthesis of pro-inflammatory cytokines such as TNFα may be beneficial in decreasing the inappropriate immune activation characteristic of HIV infection.

and this suppression of the synthesis of pro-inflammatory cytokines is also given as a hypothetical mechanism of action in SARS cases.

gr3_hypothesis_chloroquine
Hypothetical model for the potential effects of chloroquine (CQ) on the immunopathogenesis of severe acute respiratory syndrome (SARS). Proinflammatory cytokines are thought to be important in acute respiratory distress syndrome (ARDS). We hypothesise that chloroquine (black arrow), by inhibiting TNFα and interleukin 6 (IL6) production, might block the subsequent cascade of events, which leads to ARDS. (https://doi.org/10.1016/S1473-3099(03)00806-5)

and this final summary of the paper deserves special recognition:

Finally, we want to share with the scientific community the speculative hypothesis that chloroquine/hydroxychloroquine, due to its antiviral and anti-inflammatory properties, may have some effect on SARS. We emphasise the need of testing in cell cultures infected with SARS coronavirus the effects of chloroquine, as well as those ofother substances possessing in-vitro activity against members of the coronaviridae family. We should remember that the possibility of new outbreaks of SARS cannot be excluded. In the absence of effective inhibitors of SARS coronavirus, the possibility of an inhibition, at least in vitro, of the replication of this virus would represent a breakthrough in the knowledge of SARS.

2. Chloroquine is a potent inhibitor of SARS coronavirus infection and spread, Vincent et. al, Aug. 2005

We have identified chloroquine as an effective antiviral agent for SARS-CoV in cell culture conditions, as evidenced by its inhibitory effect when the drug was added prior to infection or after the initiation and establishment of infection. The fact that chloroquine exerts an antiviral effect during pre- and post-infection conditions suggest that it is likely to have both prophylactic and therapeutic advantages.

3. New Insights into the antiviral effects of chloroquine, Savarino et. al., Feb. 2006

The broad spectrum antiviral effects of chloroquine deserve particular attention in a time in which the world is threatened by the possibility of a new influenza pandemic, and the availability of effective drugs would be fundamental during evaluation of an effective vaccine.

 

20200330 Day 90: COVID-19 Vaccine Development in the Multiverse

SARSCoV2_JuanGaertne
SARS-CoV-2 is an enveloped virus with three embedded surface proteins. This illustration is based on X-ray diffraction data. Image credit: Science Source/Juan Gaertner

Today, pnas.org published a news feature by Lynne Peeples, “Avoiding pitfalls in the pursuit of a COVID-19 vaccine“. It is commonly believed that a vaccine will protect people from the deadly complications that are associated with a SARS_COV_2 infection in about 20% of the confirmed cases. In this article, Peeples illuminates some of the reasons that make vaccine development difficult.

The basic idea behind a vaccine is to give someone “a taste” of a pathogen which is strong enough to provoke a strong enough immune response to make antibodies and weak enough not to cause illness. If all goes well, then when the vaccinated person is later infected with the pathogen of interest, then the person’s immune system will recognize the foreign pathogen and eliminate it before it can cause much damage.

Unfortunately, some vaccinated people who later become infected end up having a worse outcome than if they had not been vaccinated in the first place. This “immune backfiring” or “immune enhancement” effect can come about through at least a couple different ways. One is antibody-dependent enhancement (ADE) and another is cell-based enhancement (CBE). Prior vaccines developed for SARS have shown to have this effect and it is unclear if vaccines for COVID19 will also.

Preliminary experimental evidence rejects the hypothesis that ADE is causing any immune enhancement. However, a type of CBE involving T-helper cell (Th2) response was found to be an issue in the development of a SARS vaccine. With the SARS vaccine, the immune enhancement was believed to have been solved by only using a portion of the coronavirus spike protein (that forms the crown/corona sticking up through the bi-lipid membrane).

So, there are universes in which COVID-19 is not a threat to the world. Many of these involve a vaccine that is developed and tested over the next 18 months. Which vaccine it will be, and how immune enhancement will be avoided, will depend on the universe.

Interesting addendum: CNN is now reporting 3003 COVID-19 deaths in the US – an interesting number given the date 03/30, which formatted in European format would be 30/03. I find that a bit synchronistic. It’s also somewhat interesting that 160,698 is factored into only 3 primes, with the two smallest being 2 and 3 ( 2 x 3 x 26783 – 160698).

Screen Shot 2020-03-30 at 9.56.43 PM

And, for fun pretending to be diving down a rabbit hole, I just googled images related to 26783 and there is a promoted image for the number. What could “House of Wu” mean? Wuhan? The plot thickens 🙂

Screen Shot 2020-03-30 at 10.06.36 PM

 

20200220h Day 51: Aliens are Among Us and Within Us

milky-way-arms-suns-location-orion-cygnus-arm

Image: Artist’s concept of our Milky Way galaxy, as seen from far galactic north (the direction of the constellation Coma Berenices) via NASA/ JPL-Caltech/ R. Hurt/ Wikimedia Commons.

Laniakea, Virgo, Via Lactea, Orion Spur, Sol Terrae:  Aliens are among us and within us – we call them viruses. As evolved multicellular life forms, we don’t even recognize viruses as being “alive”. I imagine that viruses consider us as aliens, or perhaps even as non-alive, in the same way as we see rocks, computers, and robots as non-alive. To a virus, our body is just a place to live like the Earth is for us. Luckily for viruses, they have billions of “virus earths” on which to live and they can migrate quite rapidly to new “virus earths” whenever they destroy the virus earth on which they feed and reproduce.

Where did these alien viruses come from? Recently, the first detection of sugars in meteorites was reported (PNAS paper: https://doi.org/10.1073/pnas.1907169116). In 2008, extraterrestrial nucleobases were found in a meteorite (https://doi.org/10.1016/j.epsl.2008.03.026). Thus far, full DNA/RNA strands or viruses have not been found on meteorites, although in 2014 an experiment showed that both are possible to survive entry into Earth’s atmosphere (https://doi.org/10.1371/journal.pone.0112979).

Given the infinite time that the multiverse has existed (with some support for this idea here: https://phys.org/news/2015-02-big-quantum-equation-universe.html), there is certainly an abundance of time for viruses to arise. The fact that all life on earth share a common ancient genetic code, and that evidence of life on Earth existing shortly after the formation of Earth, points to either a single, rare arrival on Earth or a single, rare creation event on Earth. If via arrival, then there still needs to be a single, rare creation event somewhere else. So the only difference is on the rarity of the creation event and where it occurred. Given infinite time and space, it is all but certain that viruses and life as we know it exists elsewhere.

 

20200218T Day 49: Kentaro Iwata leads Infectious Disease Control on Diamond Princess in Another Universe

After watching Kentaro Iwata’s video about his evaluation of infectious disease control (or lack thereof) on the Diamond Princess cruise ship, I can safely say there are quite a number of universes in which he was chosen to lead the ID control effort and the spread of COVID-19 was much less. His comments summarizing his findings are revealing:

Diamond Princess has completely inadequate infection control, and there is no professional ID person in charge. Passengers, crews, health care professionals working inside are at risk of infection, and the practice is even worse than what I saw in Africa. Immediate action is needed to save people inside.

I was curious about how the experience of the Diamond Princess compares with past infections of Influenza and found this 2010 paper: Outbreaks of Pandemic (H1N1) 2009 and Seasonal Influenca A (H3N2) on Cruise Ship. A summary of the paper’s findings:

To determine the extent and pattern of influenza transmission and effectiveness of containment measures, we investigated dual outbreaks of pandemic (H1N1) 2009 and influenza A (H3N2) that had occurred on a cruise ship in May 2009. Of 1,970 passengers and 734 crew members, 82 (3.0%) were infected with pandemic (H1N1) 2009 virus, 98 (3.6%) with influenza A (H3N2) virus, and 2 (0.1%) with both.

Does the increased infection rate of COVID-19 on the Princess Diamond mean that COVID-19 is that much more infectious? Or does it mean that, as Kentaro Iwata noticed, there was no real infectious disease control occurring on the Princess Diamond.

Update 2020-0219: Adding graph of Princess Diamond infections-to-date. I wonder how this graph looks in the universes where Kentaro Iwata, or someone equally qualified, was in charge. I hate feeling the universe where someone knew that the ship infectious disease control was substandard and decided against saying anything out of a desire to get “real data” on how COVID-19 spreads in a “more realistic” environment.

Screen Shot 2020-02-19 at 12.37.52 PM

20200217M Day 48: 3rd and 4th days of Influenza A in Austin

On the 3rd day of my partner’s flu-like symptoms, she started feeling better and we took a walk along Town Lake. Since she had tested negative for the flu three days ago, we both  were engaged in a bit of wishful thinking that her flu symptoms were only symptoms of a bad cold.

On the 4th day of my partner’s flu-like symptoms (I’m writing this blog a day late on Tues – not surfing to the future), she started feeling much worse and I also noticed a knot in the back of my throat similar to the symptom she felt the day before she got sick. We went to a different urgent care and they tested us both for Strep and Flu. I tested negative for both and my partner tested positive for Influenza A.

At this second urgent care, I noticed different behavior by the check-in nurse. Once my partner began describing her symptoms, the check-in nurse causally opened a drawer to get a mask to put on. My partner was already wearing a mask. Three days ago, the sign seemed to imply masks were only for possible coronavirus patients.

The doc said that Influenza A could have been contagious a day before symptoms showed up until now and likely not so contagious anymore. He said the incubation period was 1-2 days and so I may have dodged the Influenza A bullet when I was in close contact her before she showed symptoms.

Her symptoms now include fever, cough, and shortness of breath.  According to https://www.cdc.gov/coronavirus/2019-ncov/about/symptoms.html, these are the same symptoms for COVID-19 and may also appear as soon as two days after exposure.  Currently, recent travel to China seems to be the only additional screening question to determine if someone has a COVID-19 infection or not. As universes where COVID-19 is a pandemic continue to surround our universe, this “recent travel to China” question will become less and less useful. Her other symptoms are weakness, tiredness, headache, and extreme bone/muscle aches. I believe these are also present with many cases of COVID-19.

IMG_1851

I just took dose 1 of Oseltamivir Phosphate 75mg (Tamiflu) as a preventative to help me attract universes where I don’t have Influenza A replicating in my body. The toast (and banana not shown) will hopefully make the medicine go down easier and avoid the nausea side effect that is most often mentioned in reviews of this drug. Within five minutes of taking it, I felt a bit anxious with my head feeling kinda tingly.

I was uncertain about taking Tamiflu (generic). This paper, and encouragement from my partner to avoid Influenza A at all costs, gave me the feeling that it was the decision I felt most comfortable taking.

 

20200211T Day 42: Surfing to a Universe where I analyze viral genomes

As an experiment, I’m going to try surfing to a universe where I analyze viral genomes. I had an early interest in the novel coronavirus outbreak over a month ago.  I felt myself moving close to universes where there was a coronavirus pandemic in 2020 Day 17: Wuhan Coronavirus infections in Thailand and Japan in which I wrote:

This morning I thought it would be interesting to use this blog as a way to experiment with quantum feeling parallel worlds. My hypothesis is that parallel worlds can be sensed, and that the feeling of sensing a parallel world is correlated with the feeling of a synchronicity, and furthermore that the synchronicity is related to an event that ties the parallel worlds together. For example, eight days ago I sensed a parallel world in which the Wuhan Coronavirus was a bigger event than it was in this world.

There’s not currently a pandemic in the strictest sense of the word, with the only country experiencing an outbreak thus far being China (ignoring the Diamond Princess cruise ship that recently had a doubling of cases to 135). The novel coronavirus has been provisionally named 2019-nCoV. A new name, SARS-CoV-2, has been proposed by the International Committee on Taxonomy of Viruses. The disease caused by SARS-CoV-2 has been named by the WHO as COVID-19.

In the universes where I analyze viral genomes, I am almost certainly analyzing SARS-CoV-2. I’m curious where this universe surfing will lead …

20200202 Day 33: First Palindrome Date since 11/11/1111

I prefer to write my dates in YYYYMMDD format. It makes sense to me from a general-to-specific way of thinking and it also is numerically sorting friendly (at least until 10000/01/01). Whether using YYYYMMDD format, MM/DD/YYYY format, or DD/MM/YYYY format, today’s date of 02/02/2002 is a palindrome. The last time this was true was 11/11/1111, which coincidentally was 909 years ago – also a palindrome number. There’s a third coincidence which is this day of the new year is day number 33 – also a palindrome number.

A palindrome is a word, phrase, or sequence that is the same when read backwards or forwards. For a parallel worlds viewpoint, palindromes are like portals to a completely different set of universes in which words or sequences are written in the opposite manner. This is because the palindrome is the same in both sets of universes even if many other things are likely to be very different. So in a universe where we count:

1,2,3,4,5,6,7,8,9,01,11,21,31,41,51,61,71,81,91,02

Then 33 and 909 are both written the same. Notice though that in these backwards number universes, the year would be 0202 and the month/day would be 20/20, so the date would actually be written differently (20/20/0202). It would still be a palindrome and still be the first palindrome in 909 years.

Palindromic sequences are also found in nature. Coronaviruses are positive-sense RNA viruses. After the SARS epidemic in 2002, researchers began studying the genome sequence of the then called “novel coronavirus”. One article, Palindromes in SARS and Other Coronaviruses, reported on a study of the collective counts of palindromes in the SARS genome compared with other coronaviruses. The researchers found that while length-four palindromes were underrepresented in coronaviruses as a group, the SARS genome was the only coronavirus to be significantly underrepresented in length-six palindromes. The abstract also noted:

Two other features are unique to the SARS sequence. First, there is a length-22 palindrome TCTTTAACAAGCTTGTTAAAGA spanning positions 25962-25983. Second, there are two repeating length-12 palindromes TTATAATTATAA spanning positions 22712-22723 and 22796-22807. Some further investigations into possible biological implications of these palindrome features are proposed.

Notice that the palindromic sequence is a matching nucleotide in reverse, so that TCTT is a palindrome for (read in reverse) AGAA. I just did a blast search of the length-22 palindromic sequence and found many hits – the vast majority were for SARS coronavirus sequences. One of these, Bat SARS-like coronavirus WIV1 (ID: KF367457.1), I noticed was also in an science mag article:

image.png

A blast alignment of Bat SARSr-CoV WIV1 with the Wuhan seafood market pneumonia virus (MN908947.3) showed a 78% sequence identity.

I more recent article, Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus, mentions this same 22-bp DNA complemented palindrome sequence as one in which a 19-nt cpsRNA (complementary palindromic small RNA) sequence was found (UUAACAAGCUUGUUAAAGA) named SARS-CoV-cpsR-19. This paper reported results which suggested, along with past research, that this small RNA plays a role in SARS-CoV infection or pathogenesis. An image from this article helps to show why these complementary palindromic small RNA sequences are important:

Screen Shot 2020-02-02 at 2.56.52 PM.png