20200220h Day 51: Aliens are Among Us and Within Us

milky-way-arms-suns-location-orion-cygnus-arm

Image: Artist’s concept of our Milky Way galaxy, as seen from far galactic north (the direction of the constellation Coma Berenices) via NASA/ JPL-Caltech/ R. Hurt/ Wikimedia Commons.

Laniakea, Virgo, Via Lactea, Orion Spur, Sol Terrae:  Aliens are among us and within us – we call them viruses. As evolved multicellular life forms, we don’t even recognize viruses as being “alive”. I imagine that viruses consider us as aliens, or perhaps even as non-alive, in the same way as we see rocks, computers, and robots as non-alive. To a virus, our body is just a place to live like the Earth is for us. Luckily for viruses, they have billions of “virus earths” on which to live and they can migrate quite rapidly to new “virus earths” whenever they destroy the virus earth on which they feed and reproduce.

Where did these alien viruses come from? Recently, the first detection of sugars in meteorites was reported (PNAS paper: https://doi.org/10.1073/pnas.1907169116). In 2008, extraterrestrial nucleobases were found in a meteorite (https://doi.org/10.1016/j.epsl.2008.03.026). Thus far, full DNA/RNA strands or viruses have not been found on meteorites, although in 2014 an experiment showed that both are possible to survive entry into Earth’s atmosphere (https://doi.org/10.1371/journal.pone.0112979).

Given the infinite time that the multiverse has existed (with some support for this idea here: https://phys.org/news/2015-02-big-quantum-equation-universe.html), there is certainly an abundance of time for viruses to arise. The fact that all life on earth share a common ancient genetic code, and that evidence of life on Earth existing shortly after the formation of Earth, points to either a single, rare arrival on Earth or a single, rare creation event on Earth. If via arrival, then there still needs to be a single, rare creation event somewhere else. So the only difference is on the rarity of the creation event and where it occurred. Given infinite time and space, it is all but certain that viruses and life as we know it exists elsewhere.

 

20200218T Day 49: Kentaro Iwata leads Infectious Disease Control on Diamond Princess in Another Universe

After watching Kentaro Iwata’s video about his evaluation of infectious disease control (or lack thereof) on the Diamond Princess cruise ship, I can safely say there are quite a number of universes in which he was chosen to lead the ID control effort and the spread of COVID-19 was much less. His comments summarizing his findings are revealing:

Diamond Princess has completely inadequate infection control, and there is no professional ID person in charge. Passengers, crews, health care professionals working inside are at risk of infection, and the practice is even worse than what I saw in Africa. Immediate action is needed to save people inside.

I was curious about how the experience of the Diamond Princess compares with past infections of Influenza and found this 2010 paper: Outbreaks of Pandemic (H1N1) 2009 and Seasonal Influenca A (H3N2) on Cruise Ship. A summary of the paper’s findings:

To determine the extent and pattern of influenza transmission and effectiveness of containment measures, we investigated dual outbreaks of pandemic (H1N1) 2009 and influenza A (H3N2) that had occurred on a cruise ship in May 2009. Of 1,970 passengers and 734 crew members, 82 (3.0%) were infected with pandemic (H1N1) 2009 virus, 98 (3.6%) with influenza A (H3N2) virus, and 2 (0.1%) with both.

Does the increased infection rate of COVID-19 on the Princess Diamond mean that COVID-19 is that much more infectious? Or does it mean that, as Kentaro Iwata noticed, there was no real infectious disease control occurring on the Princess Diamond.

Update 2020-0219: Adding graph of Princess Diamond infections-to-date. I wonder how this graph looks in the universes where Kentaro Iwata, or someone equally qualified, was in charge. I hate feeling the universe where someone knew that the ship infectious disease control was substandard and decided against saying anything out of a desire to get “real data” on how COVID-19 spreads in a “more realistic” environment.

Screen Shot 2020-02-19 at 12.37.52 PM

20200217M Day 48: 3rd and 4th days of Influenza A in Austin

On the 3rd day of my partner’s flu-like symptoms, she started feeling better and we took a walk along Town Lake. Since she had tested negative for the flu three days ago, we both  were engaged in a bit of wishful thinking that her flu symptoms were only symptoms of a bad cold.

On the 4th day of my partner’s flu-like symptoms (I’m writing this blog a day late on Tues – not surfing to the future), she started feeling much worse and I also noticed a knot in the back of my throat similar to the symptom she felt the day before she got sick. We went to a different urgent care and they tested us both for Strep and Flu. I tested negative for both and my partner tested positive for Influenza A.

At this second urgent care, I noticed different behavior by the check-in nurse. Once my partner began describing her symptoms, the check-in nurse causally opened a drawer to get a mask to put on. My partner was already wearing a mask. Three days ago, the sign seemed to imply masks were only for possible coronavirus patients.

The doc said that Influenza A could have been contagious a day before symptoms showed up until now and likely not so contagious anymore. He said the incubation period was 1-2 days and so I may have dodged the Influenza A bullet when I was in close contact her before she showed symptoms.

Her symptoms now include fever, cough, and shortness of breath.  According to https://www.cdc.gov/coronavirus/2019-ncov/about/symptoms.html, these are the same symptoms for COVID-19 and may also appear as soon as two days after exposure.  Currently, recent travel to China seems to be the only additional screening question to determine if someone has a COVID-19 infection or not. As universes where COVID-19 is a pandemic continue to surround our universe, this “recent travel to China” question will become less and less useful. Her other symptoms are weakness, tiredness, headache, and extreme bone/muscle aches. I believe these are also present with many cases of COVID-19.

IMG_1851

I just took dose 1 of Oseltamivir Phosphate 75mg (Tamiflu) as a preventative to help me attract universes where I don’t have Influenza A replicating in my body. The toast (and banana not shown) will hopefully make the medicine go down easier and avoid the nausea side effect that is most often mentioned in reviews of this drug. Within five minutes of taking it, I felt a bit anxious with my head feeling kinda tingly.

I was uncertain about taking Tamiflu (generic). This paper, and encouragement from my partner to avoid Influenza A at all costs, gave me the feeling that it was the decision I felt most comfortable taking.

 

20200211T Day 42: Surfing to a Universe where I analyze viral genomes

As an experiment, I’m going to try surfing to a universe where I analyze viral genomes. I had an early interest in the novel coronavirus outbreak over a month ago.  I felt myself moving close to universes where there was a coronavirus pandemic in 2020 Day 17: Wuhan Coronavirus infections in Thailand and Japan in which I wrote:

This morning I thought it would be interesting to use this blog as a way to experiment with quantum feeling parallel worlds. My hypothesis is that parallel worlds can be sensed, and that the feeling of sensing a parallel world is correlated with the feeling of a synchronicity, and furthermore that the synchronicity is related to an event that ties the parallel worlds together. For example, eight days ago I sensed a parallel world in which the Wuhan Coronavirus was a bigger event than it was in this world.

There’s not currently a pandemic in the strictest sense of the word, with the only country experiencing an outbreak thus far being China (ignoring the Diamond Princess cruise ship that recently had a doubling of cases to 135). The novel coronavirus has been provisionally named 2019-nCoV. A new name, SARS-CoV-2, has been proposed by the International Committee on Taxonomy of Viruses. The disease caused by SARS-CoV-2 has been named by the WHO as COVID-19.

In the universes where I analyze viral genomes, I am almost certainly analyzing SARS-CoV-2. I’m curious where this universe surfing will lead …

20200202 Day 33: First Palindrome Date since 11/11/1111

I prefer to write my dates in YYYYMMDD format. It makes sense to me from a general-to-specific way of thinking and it also is numerically sorting friendly (at least until 10000/01/01). Whether using YYYYMMDD format, MM/DD/YYYY format, or DD/MM/YYYY format, today’s date of 02/02/2002 is a palindrome. The last time this was true was 11/11/1111, which coincidentally was 909 years ago – also a palindrome number. There’s a third coincidence which is this day of the new year is day number 33 – also a palindrome number.

A palindrome is a word, phrase, or sequence that is the same when read backwards or forwards. For a parallel worlds viewpoint, palindromes are like portals to a completely different set of universes in which words or sequences are written in the opposite manner. This is because the palindrome is the same in both sets of universes even if many other things are likely to be very different. So in a universe where we count:

1,2,3,4,5,6,7,8,9,01,11,21,31,41,51,61,71,81,91,02

Then 33 and 909 are both written the same. Notice though that in these backwards number universes, the year would be 0202 and the month/day would be 20/20, so the date would actually be written differently (20/20/0202). It would still be a palindrome and still be the first palindrome in 909 years.

Palindromic sequences are also found in nature. Coronaviruses are positive-sense RNA viruses. After the SARS epidemic in 2002, researchers began studying the genome sequence of the then called “novel coronavirus”. One article, Palindromes in SARS and Other Coronaviruses, reported on a study of the collective counts of palindromes in the SARS genome compared with other coronaviruses. The researchers found that while length-four palindromes were underrepresented in coronaviruses as a group, the SARS genome was the only coronavirus to be significantly underrepresented in length-six palindromes. The abstract also noted:

Two other features are unique to the SARS sequence. First, there is a length-22 palindrome TCTTTAACAAGCTTGTTAAAGA spanning positions 25962-25983. Second, there are two repeating length-12 palindromes TTATAATTATAA spanning positions 22712-22723 and 22796-22807. Some further investigations into possible biological implications of these palindrome features are proposed.

Notice that the palindromic sequence is a matching nucleotide in reverse, so that TCTT is a palindrome for (read in reverse) AGAA. I just did a blast search of the length-22 palindromic sequence and found many hits – the vast majority were for SARS coronavirus sequences. One of these, Bat SARS-like coronavirus WIV1 (ID: KF367457.1), I noticed was also in an science mag article:

image.png

A blast alignment of Bat SARSr-CoV WIV1 with the Wuhan seafood market pneumonia virus (MN908947.3) showed a 78% sequence identity.

I more recent article, Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus, mentions this same 22-bp DNA complemented palindrome sequence as one in which a 19-nt cpsRNA (complementary palindromic small RNA) sequence was found (UUAACAAGCUUGUUAAAGA) named SARS-CoV-cpsR-19. This paper reported results which suggested, along with past research, that this small RNA plays a role in SARS-CoV infection or pathogenesis. An image from this article helps to show why these complementary palindromic small RNA sequences are important:

Screen Shot 2020-02-02 at 2.56.52 PM.png

2020 Day 25: Wuhan Coronavirus in the Year of the Rat

WuhanCoronavirus20200124

Photo Credit: The Institute of Microbiology at the Chinese Academy of Sciences released yesterday the first close-up images of the Wuhan Coronavirus.

Sixteen days ago I decided to write a blog post: 2020 Day 9: New Strain of Coronavirus found in Wuhan, China. Eight days ago I felt called to dive into the details of the Wuhan Coronavirus in a second blog post: 2020 Day 17: Wuhan Coronavirus infections in Thailand and Japan. I’m now beginning to wonder if these two blog posts will be understood more clearly through a universe surfing viewpoint that does not require time to move in only one direction, and instead allows for anyone to quantum feel possible futures. Quantum feeling is different than prediction. Prediction assumes a classical arrow of time in one direction and looks for cause-and-effect relationship to justify a predicted outcome. Quantum feeling assumes a bi-directional arrow of time and allows future events to “cause” events that precede it, in our normal classical way of measuring time. Quantum feeling starts with an unexpected event – such as me deciding to blog about a new strain of coronavirus – and then imagines different futures that would be connected to that unexpected event when looking backwards in time from the future. Quantum feeling is a key step in universe surfing because it shows you a window to your possible futures in a way that expected events, such as habits, cannot.

In the last week, the following events have happened:

  • Five days ago (Jan. 20), the first case of “Novel Coronavirus” was reported in the Republic of Korea (WHO news: Novel Coronavirus – Republic of Korea). This case involved a 35-year-old female who resides in Wuhan and who did not report visiting any wet markets (such as Huanan Seafood Wholesale Market from where environmental samples have tested positive for the virus).
  • Four days ago (Jan. 21), the CDC confirmed the first U.S. case of the Wuhan Coronavirus in a male traveler from Wuhan who resides in Seattle, Washington.
  • Three days ago (Jan. 22), researchers published an article with genomic evidence of cross-species transmission from snake to human.
  • Two days ago (Jan. 23), the CDC raised its travel alert for the coronavirus outbreak to Level 3, Avoid Nonessential Travel. The CDC is still calling it an ‘outbreak’ versus an epidemic or pandemic. Guan Yi, a virology professor at the University of Hong Kong, director of the State Key Laboratory of Emerging Infectious Diseases, and member of team that first identified SARS, believes that the scale of infection will eventually be 10 times higher than SARS. After visiting Wuhan, he said
    • “I’ve experienced so much and I never felt scared. Most of them are controllable. But this time I’m afraid.”

  • Yesterday (Jan. 24), the CDC confirmed the second U.S. case in a female traveler from Wuhan (Jan. 13) who resides in Chicago, Illinois. Over 1200 confirmed cases and at least 41 deaths in mainland China have been tied to the Wuhan Coronavirus. Factcheck reports that social media posts are spreading a bogus Coronavirus conspiracy theory that the virus was made in a lab and purposely released in order to make money selling a vaccine that has already been developed. Researchers reported in a preprint that basic reproduction number of the Wuhan coronavirus infection (R_0) is 3.6-4.0, which indicates that to keep the number of infections from increasing, 72-75% of the transmissions must be prevented by control measures. The first cases (3 in France) of the virus were confirmed in Europe. Cases of the coronavirus have been confirmed now in Mainland China (1287), France (3), Hong Kong (5), Japan, Macau (2), Nepal, Australia (1), Singapore, South Korea, Taiwan (3), Thailand, the United States (2) and Vietnam. In an interesting universe merging, Saudi Arabia denied reports of a case of Wuhan Coronavirus and instead reported that a male Indian nurse tested posted for MERS, which is caused by a different coronavirus with a similar genetic sequence. The number of google search results for “wuhan coronavirus” increased from 14.6M yesterday evening to 17.9M this morning and 20.4M this evening. For reference, MERS has 62.7M google results and SARS has 86.3M.
  • Today (Jan. 25) is the first day of the Lunar New Year – the year of the Rat, the first year of the 12-year cycle of animals. 15 cities in Hubei province are on lockdown with public and commercial transportation in and out of the cities suspended. Shanghai reported its first coronavirus death. Hong Kong leader Carrie Lam announced an emergency, closed schools for two weeks, and cancelled a four-day carnival and fireworks show.

Quantum sensing can also appear as a déjà vu feeling. Laurie Garrett, a reporter for CNN, reported yesterday that when she read reports of patients exhibiting symptoms of pneumonia as early as December 12, 2019, she had a “chilling sense of déjà vu”. Seventeen years ago she reported on the SARS virus pandemic that caused illness in at least 8000 people across 37 countries and was associated with at least 774 deaths, including 299 in Hong Kong.

Quantum sensing can also appear as fear. Guan Yi’s quote above (“but this time I’m afraid”) is not encouraging.

Universe interference can be seen when events happen that appear to come from a different universe. For instance, Dr. Liang Wudong fell ill last week and died from an Wuhan coronavirus infection. He had been the head of the ear, nose and throat department at one of Wuhan’s top hospitals, Hubei Xinhua Hospital. He was “at the front line” fighting against the coronavirus. However, he also retired last year and there’s a universe where he was not involved in fighting the coronavirus. The Wall Street Journal’s reporting was perhaps affected by this universe when someone wrote “It isn’t clear if Dr. Liang had been involved in the treatment of other patients.” Or maybe they were just trying to calm the stock market and make sure that the party continues. I’m feeling now a universe where the stock market is negatively affected by the Wuhan coronavirus.

WuhanCoronavirusCloseup20200124

Photo Credit: IVDC, China CDC

2020 Day 17: Wuhan Coronavirus infections in Thailand and Japan

This morning I thought it would be interesting to use this blog as a way to experiment with quantum feeling parallel worlds. My hypothesis is that parallel worlds can be sensed, and that the feeling of sensing a parallel world is correlated with the feeling of a synchronicity, and furthermore that the synchronicity is related to an event that ties the parallel worlds together. For example, eight days ago I sensed a parallel world in which the Wuhan Coronavirus was a bigger event than it was in this world. I believe this sensing caused me to write a blog post about coronaviruses in quite a detailed manner. Since then, the Wuhan Coronavirus (it’s slightly interesting that I called it this above as I now see that wikipedia calls it the same – not that unexpected though) has resulted in two deaths in Wuhan, two cases in Thailand, and one case in Japan.

GenBank has the complete annotated genome sequence of the Wuhan Coronavirus. NCBI has an article with the Wuhan Coronavirus phylogenetic tree, which shows the Wuhan Coronavirus close in sequence to various Bat SARS-like coronaviruses. WHO has a paper describing diagnostic detection of the Wuhan coronavirus by real-time reverse-transcription polymerase chain reaction (RT-PCR). EcoHealth Alliance has a more detailed phylogenetic analysis:

This story is still not widely reported, but has made it to The Economist.  I hope to surf to a universe where this is not a big story, but the synchronicities that found me posting this make me worry that the odds are against me.

2020 Day 9: New Strain of Coronavirus found in Wuhan, China

Wuhan is the capital of Hubei province in central China. I stopped in Wuhan a year ago instead of Hong Kong on a flight between Austin and Bangkok. The flight on China Southern was half the price of flying other airlines, like Cathay Pacific. The problem I noticed was that the weather in Wuhan was much colder than in Austin or Thailand, and so I needed to pack warmer clothes just for the layover – not ideal. Also, on the return flight through China, even though my ticket showed a single stop, the airlines ended up making a second stop and everyone had to get off the plane and wait for a couple hours to go through a customs-like search. I remember one passenger shouting during this time how annoyed he was for this surprise experience. While I was also annoyed, I also found amusement in seeing another example of the multiverse working it’s magic. I could feel the universe where we didn’t have the unexpected stop, and also the universe where the ticket displayed correctly the extra stop. I saw the universe I was experience as one created by the interference pattern of these two other universes.

Today it is being reported that the Wuhan pneumonia outbreak “mystery illness” that has infected 60 people in the last 2 weeks is caused by a new coronavirus. Coronaviruses are a species of viruses blamed for such deadly illnesses as severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS). Coronaviruses are enveloped viruses (HIV-1 is also an enveloped virus), which means they have an outer phospholipid bilayer membrane that includes some viral glycoproteins. The viral glycoproteins act as Trojan horse to gain entry into a host cell and also help the virus hide from the host immune system. Coronaviruses have a single-stranded, positive-sense, non-segmented, RNA genome which is the largest of all RNA viruses at around 30,000 bases. Because it is positive-sense and also contains a 5’ cap structure and 3’ poly (A) tail, it can mimic mRNA and be directly translated by the host of the replicase polyproteins, which are encoded by the approximately 20,000 base replicase gene. The replicase polyproteins assemble to form a viral replicase complex that, as you may guess, makes copies of the virus. The remaining 10,000 or so bases encode structural and accessory proteins. The four main structural proteins (all encoded within the 3’ end of the viral genome) are the spike, membrane, envelope, and nucelocapsid proteins. The spike protein has an N-terminal signal sequence that allows it to gain access to the host cell endoplasmic reticulum where it is heavily N-linked glycosylated. Three spike proteins join together to form a club-shape spike projection. These virion projections give the virus the appearance of a solar corona, from which their name derives. For a size perspective, the diameter of the coronaviruse virion is about 125 nm, so a meter long thin straw of diameter 125 nm filled with the virions would contain 8 million virions. For comparison, a single nucleotide is 0.33 nm long and so 30,000 bases has a length of 10,000 nm! Imagine fitting that into a 125 nm diameter virion.

Four identified coronaviruses (HCoV-229E, HCoV-NL63, HCoV-OC43, and HCoV-HKU1) are endemic in humans and cause up to 30% of respiratory tract infections worldwide each year. HCoV-NL63 has been associated with acute laryngotracheitis (croup). Coronoviruses have different tolerances to genetic variability with some (i.e. HCoV-229E) having little genetic variability worldwide and primarily isolated in humans and others (i.e. HCoV-OC43) showing high genetic variability across time and location. Most cases of coronavirus infection are self-limiting and will naturally run its course.

I’ve been sick with a respiratory infection for about two weeks. A few days ago I tried out my video-doctor health plan and got a prescription for Amoxicillin antibiotics. I also went to Accupuncture and purchased some Chinese herbs. I didn’t pick up the antibiotics prescription and I tried the herbs instead. That night I didn’t sleep well and I felt my body releasing a lot of toxins. My throat was still feeling scratching in the morning with nasal drip collecting in the back of my throat. Once I spit the thick yellow mucus out each morning, I felt fine. I decided to treat myself with water and rest over the next couple of days. I felt the universe where I was taking the antibiotics. I felt the universe where I had continued taking the herbs. I felt the universe where I was drinking more water and resting (and taking a zinc lounge now and then for good luck). Right now I still feel like I have a swollen throat, but it isn’t sore. I didn’t have much mucus this morning. My nasal passages are mostly clear. I expect the three universes to merge together tomorrow and I will feel infection free. Now if I could just find a way to clear the cedar pollen out of the air!

REFERENCE: Methods Mol Biol. 2015; Pehr and Perlman, Coronaviruses: An Overview of Their Replication and Pathogenesis