20200209u Day 40: Conspiracy Theories in Multiple Realities

Screen Shot 2020-02-09 at 10.06.33 PM

When feeling into the quantum field of multiple worlds, I find it difficult to not fall down a rabbit hole of conspiracy theories. One thing I do to stay grounded is pay attention to the classical facts that are continually present in the universe I’m in. I also acknowledge that due to the infinite nature of parallel worlds, almost all conspiracy theories are true in at least one reality. I don’t ask myself then whether a conspiracy theory is true or not. Instead, I ask myself how close it is to me – to my current classical reality. I also underweight conspiracy theories that I sense are being promoted for reasons other than reporting the truth.

As an example, consider the recent research paper which was preprinted on bioRxiv on Jan. 31, 2020 (doi: http://dx.doi.org/10.1101/2020.01.30.927871) entitled Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag. This paper was retracted only a few days later. Some comments about it …

From https://www.statnews.com/2020/02/03/retraction-faulty-coronavirus-paper-good-moment-for-science/ :

The paper, from academic institutions in New Delhi, India, was critical and alarming, if true. Except that it wasn’t.

and this from https://theprepared.com/blog/no-the-2019-ncov-genome-doesnt-actually-seem-engineered-from-hiv/

In other words, the sequence overlap is not actually uncanny, and there is no big scoop here. The group in India fell prey to some of the pitfalls of bioinformatics research.

and factcheck.org also debunked the research article as a baseless conspiracy theory:

Several online stories inaccurately claim that the new coronavirus contains HIV “insertions” and shows signs of being created in a lab. But there is no evidence that the new virus was bioengineered, and every indication it came from an animal.

and ChinaDaily.com.cn article Coronavirus conspiracy debunked by Wuhan researcher:

A scientist from the Wuhan Institute of Virology of the Chinese Academy of Sciences has debunked a recent conspiracy which claimed the novel coronavirus was manufactured and escaped from the institute’s most advanced biocontainment facility.

Shi Zhengli, a researcher from the institute, said on her social media on Sunday the virus was the result of “nature punishing the uncivilized habits and customs of humans”, and she is willing to “bet my life that [the outbreak] has nothing to do with the lab.”

Shi was the leading scientist who made the discovery the novel coronavirus can enter cells through ACE2 receptors and may have originated from bats.

Her comments came after Indian scientists recently published a non-peer reviewed paper suggesting scientists had artificially inserted genes from the HIV virus into the coronavirus, thus making it susceptible to anti-HIV treatments.

The paper was immediately panned by experts around the world and retracted from biology journal server bioRxiv on Sunday.

In a Twitter post commenting on the paper, David Liu, a chemistry professor from Harvard University, said: “The mere claim that such short inserts support nCoV origins ‘unlikely to be fortuitous in nature’ is already highly suspect.”

“This is a classic case of searching for lost keys only under a lamppost,” he said. “A fearful world does not need to fuel conspiracy theories with bad analyses.”

The last quote about searching for lost keys only under a lamppost is one I especially like. I’ve often told that joke. However, I’ve also learned that I can find my lost keys specifically by looking for them “under a lamppost”. I don’t end up finding them there, but the act of looking for them there seems to removed the lamppost as a possibility and once I’ve checked enough lampposts, then I can often look in the grass between the lampposts and find them.

After withdrawing the paper preprint, one of the authors commented:

While we appreciate the criticisms and comments provided by scientific colleagues at BioRxiv forum and elsewhere, the story has been differently interpreted and shared by social media and news platforms.

We have positively received all criticisms and comments. To avoid further misinterpretation and confusions world-over, we have decided to withdraw the current version of the preprint.

But just when you think everyone is in the same universe, evidence of interference between two sets of universes – one natural virus and one man-made virus – is still seen. The Taiwan News reports Chinese military news agency discloses 2019-nCoV was product of lab: Guide Wengui:

As conspiracies about the origin of the Wuhan coronavirus (2019-nCoV) surface in recent weeks, exiled Chinese businessman Guo Wengui (郭文貴) said on Tuesday (Feb. 4) that Chinese military news network Xilu claimed the virus was engineered by the United States, which is strangely at odds with what Chinese health authorities have said.

@DrEricDing has some ideas on threader journalling his trip down the rabbit hole – with references!

At this point, the origin of 2019-nCoV is still in a superposition of states (wild and man-made), at least for most of the people on the planet.

 

 

20200208S Day 39: Using Full Moon Nights to Wormhole to Far Away Universes

I started writing daily blog posts on this wordpress blog at the beginning of the year 2020. I imagine that in many nearby parallel universes, I also started writing daily blog posts on this date as it is customary to have new year’s resolutions to mark the beginning of the Julian calendar. However, there are many other calendars in use across the world. It’s possible for me to surf to universes where the Julian calendar is not the chosen calendar of the West, or even universes where it doesn’t exist.

Imagine a world in which the moon phases and the seasons mark the passing of time. This world is know to be in our past and is also almost certainly in our possible futures. On the night of a full moon, it is possible to communicate with your parallel self across all the universes in which your parallel self is communicating back. While this is a somewhat arbitrary time to choose to communicate, it’s more likely than not that it would be a special time to communicate. Full moon ceremonies and gatherings are popular in the classical universe we experience and it takes only a small leap of faith to know that full moon nights are a sacred time across the multiverse.

So, I plan to use the remainder of the night before I sleep to meditate and attempt to communicate with my parallel self. I also plan to imagine a new habit I want to start for the next moon cycle – specifically a habit that I might have in a far, far away universe where there is no Julian calendar to guide me.

20200207F Day 38: Wuhan Central Hospital Doctor Li Wenliang is 638th Confirmed Death from 2019 Novel Coronavirus

image.png

It was reported in the last 24 hours that Dr. Li Wenliang died of the novel coronavirus disease at the age of 34. His time of death was noted as 2:58am on Friday by the hospital. Earlier in the day he had been reported both dead and alive, as if he were a Schrödinger’s Cat. The many-worlds interpretation of quantum mechanics is a useful model of reality. Using this interpretation/model, Dr. Li is in many universes still combating the coronavirus and saving lives. His continued work in these other universes will help us here in this universe.

Dr. Li was one of the first doctors to identify a SARS-like coronavirus infection. He reported it at 17:43 on 2019-12-30 in a WeChat group of his med school classmates. After snapshots of his WeChat messages were posted online, he was accused by police of “making false comments on the Internet”.  He was admitted to intensive care on 2020-01-12 and his infection was not confirmed as novel coronavirus until 2020-02-01.

There are a set of universes where Dr. Li’s warnings were reported earlier and the coronavirus outbreak was contained. People resonating with the energy of these universes will help ease the crisis we are experiencing in this one. The actions of China’s Supreme People’s Court to speak against the police accusations is an example of this energy resonating.

 

20200206h Day 37: NPR Interview with David Quammen Notes Mapped to the Multiverse

Some points to consider from the NPR interview on the novel coronavirus with science write David Quammen from a couple days ago:

  1. 2019-nCoV case fatality rate of (currently) 2% is in the range that should be taken seriously.
  2. The limited number of masks should be reserved for those who are sick and health care workers. They are not that effective in protecting healthy people.
  3. The chances are there – how big we don’t know – that a pandemic will one day infect and kill a large percentage of the world population.

Of these points, all involve probabilities. Nearby universes surround us with slight changes in probability. Farther away universes have larger changes in probability. So, a nearby universe would be one where the 2019-nCoV case fatality rate is 3% instead of 2% and a farther away one would be where it is 20% instead of 2%. The effectiveness of people wearing masks can also be similar or different in near and far universes, respectively. And the chance a pandemic will one day infect and kill a large percentage of the world population can also be used to order universes along a continuum. Each of these three measures can be thought of as a different dimension in the parallel universe space. As an example, considering only these three measures, one could visualize a 3-D space of universes by assigning number 1 to the X-axis, number 2 to the Y-axis, and number 3 to the Z-axis.

20200205W Day 36: Senate Acquits Trump as Romney votes from a parallel reality

Most of us are currently surrounded by a large percentage of universes in which the U.S. Congress representatives vote not with the leaders of the party in which they are affiliated instead of with their conscience. For those who find this appalling, there is evidence of a nearby universe in which conscience-based voting is the rule rather than the exception. This evidence is illustrated by Mitt Romney’s conscious-based vote despite strong arm-twisting by the other members of his party.

Here’s the full text of Romney’s speech explaining why he voted to remove President Trump from office today:

The Constitution is at the foundation of our Republic’s success, and we each strive not to lose sight of our promise to defend it. The Constitution established the vehicle of impeachment that has occupied both houses of Congress for these many days. We have labored to faithfully execute our responsibilities to it. We have arrived at different judgments, but I hope we respect each other’s good faith.

The allegations made in the articles of impeachment are very serious. As a Senator-juror, I swore an oath, before God, to exercise “impartial justice.” I am a profoundly religious person. I take an oath before God as enormously consequential. I knew from the outset that being tasked with judging the President, the leader of my own party, would be the most difficult decision I have ever faced. I was not wrong.

The House Managers presented evidence supporting their case; the White House counsel disputed that case. In addition, the President’s team presented three defenses: first, that there can be no impeachment without a statutory crime; second, that the Bidens’ conduct justified the President’s actions; and third that the judgement of the President’s actions should be left to the voters. Let me first address each of those defenses.

The historic meaning of the words “high crimes and misdemeanors,” the writings of the Founders and my own reasoned judgement convince me that a president can indeed commit acts against the public trust that are so egregious that while they are not statutory crimes, they would demand removal from office. To maintain that the lack of a codified and comprehensive list of all the outrageous acts that a president might conceivably commit renders Congress powerless to remove a president defies reason.

The President’s counsel noted that Vice President Biden appeared to have a conflict of interest when he undertook an effort to remove the Ukrainian Prosecutor General. If he knew of the exorbitant compensation his son was receiving from a company actually under investigation, the Vice President should have recused himself. While ignoring a conflict of interest is not a crime, it is surely very wrong.

With regards to Hunter Biden, taking excessive advantage of his father’s name is unsavory but also not a crime. Given that in neither the case of the father nor the son was any evidence presented by the President’s counsel that a crime had been committed, the President’s insistence that they be investigated by the Ukrainians is hard to explain other than as a political pursuit. There is no question in my mind that were their names not Biden, the President would never have done what he did.

The defense argues that the Senate should leave the impeachment decision to the voters. While that logic is appealing to our democratic instincts, it is inconsistent with the Constitution’s requirement that the Senate, not the voters, try the president. Hamilton explained that the Founders’ decision to invest senators with this obligation rather than leave it to voters was intended to minimize—to the extent possible—the partisan sentiments of the public.

This verdict is ours to render. The people will judge us for how well and faithfully we fulfilled our duty. The grave question the Constitution tasks senators to answer is whether the President committed an act so extreme and egregious that it rises to the level of a “high crime and misdemeanor.”

Yes, he did.

The President asked a foreign government to investigate his political rival.

The President withheld vital military funds from that government to press it to do so.

The President delayed funds for an American ally at war with Russian invaders.

The President’s purpose was personal and political.

Accordingly, the President is guilty of an appalling abuse of the public trust.

What he did was not “perfect”— No, it was a flagrant assault on our electoral rights, our national security interests, and our fundamental values. Corrupting an election to keep oneself in office is perhaps the most abusive and destructive violation of one’s oath of office that I can imagine.

In the last several weeks, I have received numerous calls and texts. Many demand that, in their words, “I stand with the team.” I can assure you that that thought has been very much on my mind. I support a great deal of what the President has done. I have voted with him 80% of the time. But my promise before God to apply impartial justice required that I put my personal feelings and biases aside. Were I to ignore the evidence that has been presented, and disregard what I believe my oath and the Constitution demands of me for the sake of a partisan end, it would, I fear, expose my character to history’s rebuke and the censure of my own conscience.

I am aware that there are people in my party and in my state who will strenuously disapprove of my decision, and in some quarters, I will be vehemently denounced. I am sure to hear abuse from the President and his supporters. Does anyone seriously believe I would consent to these consequences other than from an inescapable conviction that my oath before God demanded it of me?

I sought to hear testimony from John Bolton not only because I believed he could add context to the charges, but also because I hoped that what he said might raise reasonable doubt and thus remove from me the awful obligation to vote for impeachment.

Like each member of this deliberative body, I love our country. I believe that our Constitution was inspired by Providence. I am convinced that freedom itself is dependent on the strength and vitality of our national character. As it is with each senator, my vote is an act of conviction. We have come to different conclusions, fellow senators, but I trust we have all followed the dictates of our conscience.

I acknowledge that my verdict will not remove the President from office. The results of this Senate Court will in fact be appealed to a higher court: the judgement of the American people. Voters will make the final decision, just as the President’s lawyers have implored. My vote will likely be in the minority in the Senate. But irrespective of these things, with my vote, I will tell my children and their children that I did my duty to the best of my ability, believing that my country expected it of me. I will only be one name among many, no more or less, to future generations of Americans who look at the record of this trial. They will note merely that I was among the senators who determined that what the President did was wrong, grievously wrong.

We’re all footnotes at best in the annals of history. But in the most powerful nation on earth, the nation conceived in liberty and justice, that is distinction enough for any citizen.

 

20200204 Day 35: Feb 28 Cases Peak 145,000 and Deaths Peak 2,000

Assuming no outbreaks in other countries, using the official numbers reported to date by China, and hoping for the best, the number of worldwide reported cases peak at 145,000 and number of deaths peak at 2,000.

Date /2020 Total Cases China Cases China Severe China Deaths Ex China Cases Ex China Deaths
1/21 282 278 63 6 4 0
1/22 314 309 63 6 5 0
1/23 581 571 95 17 10 0
1/24 864 830 177 25 34 0
1/25 1320 1287 237 41 33 0
1/26 2014 1985 324 56 29 0
1/27 2798 2741 491 80 37 0
1/28 4593 4537 976 106 56 0
1/29 6065 5997 1239 132 68 0
1/30 7818 7736 1370 170 82 0
1/31 9826 9720 1527 213 109 0
2/1 11953 11821 1795 259 132 0
2/2 14557 14411 2110 304 146 1
2/3 17391 17238 2296 361 153 1
2/4 20628 20438 2498 425 155 2
2/5 24292 24019 2719 496 156 2
2/6 28403 27978 2958 574 157 3
2/7 32971 32303 3219 658 157 4
2/8 38000 36969 3503 749 159 6
2/9 43483 41935 3812 844 160 9
2/10 49400 47150 4148 944 162 13
2/11 55721 52547 4513 1046 164 18
2/12 62401 58045 4911 1149 165 24
2/13 69382 63554 5344 1252 167 31
2/14 76591 68974 5815 1352 168 39
2/15 83944 74196 6328 1447 170 46
2/16 91344 79112 6885 1536 172 53
2/17 98685 83609 7492 1616 174 59
2/18 105853 87585 8153 1686 175 63
2/19 112728 90942 8872 1743 177 67
2/20 119191 93595 9654 1787 179 68
2/21 125122 95478 10505 1817 181 69
2/22 130408 96541 11431 1831 182 69
2/23 134945 96757 12438 1838 184 69
2/24 138639 97615 13535 1856 186 70
2/25 141415 98591 14728 1874 188 71
2/26 143214 99577 16026 1893 190 72
2/27 143998 100573 17439 1912 192 72
2/28 145047 101578 18976 1931 194 73

20200203 Day 34: Iowa Democratic Caucus Results in Parallel Universes

In some universes, the final results of the Iowa Democratic Caucus have been released and the winner is …

In the universe I’m in right now, the results have been delayed. The reason for the delay is still being observed and is currently in a superposition of states such as “app failure”, “dotting i’s and crossing t’s”, “waiting for coins to flip”, “back room negotiations”, “quality control”, “busy phone lines”, and “conspiracy against Bernie”.

In the majority of parallel universes, the top three candidates ordered by number of state delegates is:

  1. Bernie
  2. Buttigieg
  3. Warren

with Klobuchar and Biden splitting almost all of the remainder, except for one Yang delegate.

#IowaCaucus

20200202 Day 33: First Palindrome Date since 11/11/1111

I prefer to write my dates in YYYYMMDD format. It makes sense to me from a general-to-specific way of thinking and it also is numerically sorting friendly (at least until 10000/01/01). Whether using YYYYMMDD format, MM/DD/YYYY format, or DD/MM/YYYY format, today’s date of 02/02/2002 is a palindrome. The last time this was true was 11/11/1111, which coincidentally was 909 years ago – also a palindrome number. There’s a third coincidence which is this day of the new year is day number 33 – also a palindrome number.

A palindrome is a word, phrase, or sequence that is the same when read backwards or forwards. For a parallel worlds viewpoint, palindromes are like portals to a completely different set of universes in which words or sequences are written in the opposite manner. This is because the palindrome is the same in both sets of universes even if many other things are likely to be very different. So in a universe where we count:

1,2,3,4,5,6,7,8,9,01,11,21,31,41,51,61,71,81,91,02

Then 33 and 909 are both written the same. Notice though that in these backwards number universes, the year would be 0202 and the month/day would be 20/20, so the date would actually be written differently (20/20/0202). It would still be a palindrome and still be the first palindrome in 909 years.

Palindromic sequences are also found in nature. Coronaviruses are positive-sense RNA viruses. After the SARS epidemic in 2002, researchers began studying the genome sequence of the then called “novel coronavirus”. One article, Palindromes in SARS and Other Coronaviruses, reported on a study of the collective counts of palindromes in the SARS genome compared with other coronaviruses. The researchers found that while length-four palindromes were underrepresented in coronaviruses as a group, the SARS genome was the only coronavirus to be significantly underrepresented in length-six palindromes. The abstract also noted:

Two other features are unique to the SARS sequence. First, there is a length-22 palindrome TCTTTAACAAGCTTGTTAAAGA spanning positions 25962-25983. Second, there are two repeating length-12 palindromes TTATAATTATAA spanning positions 22712-22723 and 22796-22807. Some further investigations into possible biological implications of these palindrome features are proposed.

Notice that the palindromic sequence is a matching nucleotide in reverse, so that TCTT is a palindrome for (read in reverse) AGAA. I just did a blast search of the length-22 palindromic sequence and found many hits – the vast majority were for SARS coronavirus sequences. One of these, Bat SARS-like coronavirus WIV1 (ID: KF367457.1), I noticed was also in an science mag article:

image.png

A blast alignment of Bat SARSr-CoV WIV1 with the Wuhan seafood market pneumonia virus (MN908947.3) showed a 78% sequence identity.

I more recent article, Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus, mentions this same 22-bp DNA complemented palindrome sequence as one in which a 19-nt cpsRNA (complementary palindromic small RNA) sequence was found (UUAACAAGCUUGUUAAAGA) named SARS-CoV-cpsR-19. This paper reported results which suggested, along with past research, that this small RNA plays a role in SARS-CoV infection or pathogenesis. An image from this article helps to show why these complementary palindromic small RNA sequences are important:

Screen Shot 2020-02-02 at 2.56.52 PM.png

2020 Day 32: The 32 Paths of Wisdom

To finish the story from 2020 Day 31 Addendum 1: The washer looks damaged, my brother decided to be in the universe where he had a washing machine, even though it was dented. This did result in him getting a 10% discount.

For this day 32, I felt a universe where I talk about math, binary numbers, base 32 numbers, and counting to 32 with one hand. I also felt a universe where I wrote about the 32 Paths to Wisdom. I’m leaning towards the second universe …

 

2020 Day 31 Addendum 1: The washer looks damaged

I just posted my Day 31 post 2020 Day 31: Delivering a washing machine through the multiverse with an ending comment:

From what I know about universe surfing and parallel universe interference, I suspect that there are more interesting universe collisions to come around this series of events.

I just heard from my brother, relaying a quote from the delivery guy:

The washer looks damaged

More universe surfing to come …