I prefer to write my dates in YYYYMMDD format. It makes sense to me from a general-to-specific way of thinking and it also is numerically sorting friendly (at least until 10000/01/01). Whether using YYYYMMDD format, MM/DD/YYYY format, or DD/MM/YYYY format, today’s date of 02/02/2002 is a palindrome. The last time this was true was 11/11/1111, which coincidentally was 909 years ago – also a palindrome number. There’s a third coincidence which is this day of the new year is day number 33 – also a palindrome number.
A palindrome is a word, phrase, or sequence that is the same when read backwards or forwards. For a parallel worlds viewpoint, palindromes are like portals to a completely different set of universes in which words or sequences are written in the opposite manner. This is because the palindrome is the same in both sets of universes even if many other things are likely to be very different. So in a universe where we count:
1,2,3,4,5,6,7,8,9,01,11,21,31,41,51,61,71,81,91,02
Then 33 and 909 are both written the same. Notice though that in these backwards number universes, the year would be 0202 and the month/day would be 20/20, so the date would actually be written differently (20/20/0202). It would still be a palindrome and still be the first palindrome in 909 years.
Palindromic sequences are also found in nature. Coronaviruses are positive-sense RNA viruses. After the SARS epidemic in 2002, researchers began studying the genome sequence of the then called “novel coronavirus”. One article, Palindromes in SARS and Other Coronaviruses, reported on a study of the collective counts of palindromes in the SARS genome compared with other coronaviruses. The researchers found that while length-four palindromes were underrepresented in coronaviruses as a group, the SARS genome was the only coronavirus to be significantly underrepresented in length-six palindromes. The abstract also noted:
Two other features are unique to the SARS sequence. First, there is a length-22 palindrome TCTTTAACAAGCTTGTTAAAGA spanning positions 25962-25983. Second, there are two repeating length-12 palindromes TTATAATTATAA spanning positions 22712-22723 and 22796-22807. Some further investigations into possible biological implications of these palindrome features are proposed.
Notice that the palindromic sequence is a matching nucleotide in reverse, so that TCTT is a palindrome for (read in reverse) AGAA. I just did a blast search of the length-22 palindromic sequence and found many hits – the vast majority were for SARS coronavirus sequences. One of these, Bat SARS-like coronavirus WIV1 (ID: KF367457.1), I noticed was also in an science mag article:

A blast alignment of Bat SARSr-CoV WIV1 with the Wuhan seafood market pneumonia virus (MN908947.3) showed a 78% sequence identity.
I more recent article, Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus, mentions this same 22-bp DNA complemented palindrome sequence as one in which a 19-nt cpsRNA (complementary palindromic small RNA) sequence was found (UUAACAAGCUUGUUAAAGA) named SARS-CoV-cpsR-19. This paper reported results which suggested, along with past research, that this small RNA plays a role in SARS-CoV infection or pathogenesis. An image from this article helps to show why these complementary palindromic small RNA sequences are important:


One thought on “20200202 Day 33: First Palindrome Date since 11/11/1111”